Euplotid nuclear code
The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae. The euplotid code is a socalled "symmetrical code", which results from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. In 2013, shCherbak and Makukov, reported that "the patterns are shown to match the criteria of an intelligent signal."
It was already know that the code was near or at an optimum for buffering genetic mistakes, but the analyses of shCherback and Makukov demonstrated that the arrangements of the code reveal an ensemble of arithmetical and ideographical patterns of the same symbolic language. Accurate and systematic, these underlying patterns appear as a product of precision logic and nontrivial computing rather than of stochastic processes (the null hypothesis that they are due to chance coupled with presumable evolutionary pathways is rejected with P-value < 10–13). The patterns are profound to the extent that the code mapping itself is uniquely deduced from their algebraic representation. The signal displays readily recognizable hallmarks of artificiality, among which are the symbol of zero, the privileged decimal syntax and semantical symmetries. Besides, extraction of the signal involves logically straightforward but abstract operations, making the patterns essentially irreducible to any natural origin. Overall, while the code is nearly optimized biologically, its limited capacity is used extremely efficiently to pass non-biological information.[1]
The code
AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (10) | Standard code (1) | |
|---|---|---|---|---|
TGA |
UGA |
Cys (C) |
STOP = Ter (*)
|
Systematic range
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ shCherbak, Vladimir I.; Makukov, Maxim A. (May 2013). "The 'Wow! signal' of the terrestrial genetic code". Icarus. 224 (1): 228–242. arXiv:1303.6739. Bibcode:2013Icar..224..228S. doi:10.1016/j.icarus.2013.02.017. S2CID 16507813.
- ^ D. C. Hoffman; R. C. Anderson; M. L. DuBois; D. M. Prescott (25 April 1995). "Macronuclear gene-sized molecules of hypotrichs". Nucleic Acids Res. 23 (8): 1279–83. doi:10.1093/nar/23.8.1279. PMC 306850. PMID 7753617.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 19 March 2016.